Luận án Tiến sĩ Y học: Nghiên cứu các đột biến TP53, BRAF trong mô ung thư da và mối liên quan của nó với các thể bệnh

10,065
170
140
48
2.2.3.3. Phương pháp điện di kiểm tra DNA
Nguyên lý:
DNA đại phân tử tích điện âm, trong điện trường điện thế và
cường độ thích hợp DNA sẽ di chuyển từ cực âm sang cực dương.
Để kiểm tra và xác định tính chất của DNA, cần điện di DNA trên gel.
Phân tử DNA càng nhỏ di chuyển càng nhanh.
Để quan sát hình ảnh điện di, nhuộm DNA bằng Ethidium bromide,
dưới ánh sáng tử ngoại DNA gắn với Ethidium bromide sẽ phát sáng.
Tiến hành:
- Chuẩn bị gel nồng độ 0,8%: lấy 0,6g Agarose hòa tan trong 48ml TBE.
+ Đun sôi 2 - 3 phút bằng lò vi sóng
+ Để thạch nguội khoảng 70
0
C rồi tạo giếng.
- Đặt thạch vào khay điện di.
- Viết sơ đồ các mẫu DNA điện di.
- Lấy 5µl DNA trộn với 2µl chỉ thị bromphenol blue, nhỏ dung dịch đã trộn
vào giếng theo thứ tự như ở sơ đồ.
- Điện di ở hiệu điện thế 100mV trong 30 phút.
- Nhuộm Ethidium bromide.
- Dùng hệ thống UVP chụp ảnh gel và phân tích kết quả.
2.2.3.4. Kỹ thuật PCR khuếch đại gen BRAF và TP53
Các phản ứng PCR khuếch đại đoạn gen BRAF TP53 được sử dụng cặp
mồi và Taq polymerase của hãng Sigma Aldrich (Mỹ) sản xuất.
a. Qui trình PCR khuếch đại gen BRAF
Phản ứng PCR khuếch đại đoạn gen BRAF với cặp mồi đặc hiệu phát hiện đột
biến V600E:
48 2.2.3.3. Phương pháp điện di kiểm tra DNA Nguyên lý: DNA là đại phân tử tích điện âm, trong điện trường có điện thế và cường độ thích hợp DNA sẽ di chuyển từ cực âm sang cực dương. Để kiểm tra và xác định tính chất của DNA, cần điện di DNA trên gel. Phân tử DNA càng nhỏ di chuyển càng nhanh. Để quan sát hình ảnh điện di, nhuộm DNA bằng Ethidium bromide, dưới ánh sáng tử ngoại DNA gắn với Ethidium bromide sẽ phát sáng. Tiến hành: - Chuẩn bị gel nồng độ 0,8%: lấy 0,6g Agarose hòa tan trong 48ml TBE. + Đun sôi 2 - 3 phút bằng lò vi sóng + Để thạch nguội khoảng 70 0 C rồi tạo giếng. - Đặt thạch vào khay điện di. - Viết sơ đồ các mẫu DNA điện di. - Lấy 5µl DNA trộn với 2µl chỉ thị bromphenol blue, nhỏ dung dịch đã trộn vào giếng theo thứ tự như ở sơ đồ. - Điện di ở hiệu điện thế 100mV trong 30 phút. - Nhuộm Ethidium bromide. - Dùng hệ thống UVP chụp ảnh gel và phân tích kết quả. 2.2.3.4. Kỹ thuật PCR khuếch đại gen BRAF và TP53 Các phản ứng PCR khuếch đại đoạn gen BRAF và TP53 được sử dụng cặp mồi và Taq polymerase của hãng Sigma Aldrich (Mỹ) sản xuất. a. Qui trình PCR khuếch đại gen BRAF Phản ứng PCR khuếch đại đoạn gen BRAF với cặp mồi đặc hiệu phát hiện đột biến V600E:
49
Hình 2.2. Chuẩn bị thạch, điện di DNA và hệ thống UVP
chụp ảnh gel sau khi điện di
BRAF-F:5′-CTACTGTTTTCCTTTACTTACTACACCTCAGA-3
BRAF-R:5′-ATCCAGACAACTGTTCAAACTGAT- 3
Chu trình nhiệt: 94
o
C-2 phút [94
o
C-30 giây, 58
o
C-30 giây, 72
o
C-30
giây] 35 chu kì 72
o
C-5 phút.
b. Qui trình PCR khuếch đại các đoạn gen TP53
49 Hình 2.2. Chuẩn bị thạch, điện di DNA và hệ thống UVP chụp ảnh gel sau khi điện di BRAF-F:5′-CTACTGTTTTCCTTTACTTACTACACCTCAGA-3 BRAF-R:5′-ATCCAGACAACTGTTCAAACTGAT- 3 Chu trình nhiệt: 94 o C-2 phút [94 o C-30 giây, 58 o C-30 giây, 72 o C-30 giây] 35 chu kì  72 o C-5 phút. b. Qui trình PCR khuếch đại các đoạn gen TP53
50
Mỗi mẫu đều được giải trình tự các exon 2 - 4, 5 - 6, 7 - 9 các exon
thường xảy ra đột biến trong ung thư da với các cặp mồi:
Mồi
Trình tự 5’ - 3’
Sản phẩm (bp)
Exon 2 - 4
F -TCCTGGATCCCCACTTTTCC
611
R -TCCTGGATCCCCACTTTTCC
Exon 5 - 6
F - CACTTTCAACTCTGTCTCCTTCC
378
R - CCCCCCCTACTGCTCACCCGG
Exon 7 - 9
F - TCTTCGGCCTGTGTTATCTCC
755
R -CAGGTCCCAAGACTTAGTACC
Chu kỳ luân nhiệt cho việc khuyếch đại đoạn gen như sau:
Chu kỳ luân nhiệt: 40 chu kỳ luân nhiệt:
95
o
C-5 phút [95
o
C-30 giây, 55
o
C-30 giây, 72
o
C-60 giây]x40 chu kì
72
o
C-5 phút.
c. Qui trình tinh sạch sản phẩm PCR-Sequencing
- Thêm vào mỗi giếng 32l Isopropyl alcohol (3Iso : 1 H20).
- Lắc 500 rpm/1phút ở nhiệt độ phòng 30 phút.
- Ly tâm 3600 rpm/30 phút/10
o
C.
- Ly tâm ngược plate 96rpm/30giây.
- Thêm vào mỗi giếng 80l Isopropyl alcohol 75%.
- Để ở nhiệt độ phòng 3 phút.
- Ly tâm 3600rpm/10 phút/ 10
o
C.
- Ly tâm ngược plate.
- Đặt plate vào tủ ấm 56
o
C/20 phút.
- Thêm vào mỗi giếng 10l nước cất khử ion.
50 Mỗi mẫu đều được giải trình tự ở các exon 2 - 4, 5 - 6, 7 - 9 là các exon thường xảy ra đột biến trong ung thư da với các cặp mồi: Mồi Trình tự 5’ - 3’ Sản phẩm (bp) Exon 2 - 4 F -TCCTGGATCCCCACTTTTCC 611 R -TCCTGGATCCCCACTTTTCC Exon 5 - 6 F - CACTTTCAACTCTGTCTCCTTCC 378 R - CCCCCCCTACTGCTCACCCGG Exon 7 - 9 F - TCTTCGGCCTGTGTTATCTCC 755 R -CAGGTCCCAAGACTTAGTACC Chu kỳ luân nhiệt cho việc khuyếch đại đoạn gen như sau: Chu kỳ luân nhiệt: 40 chu kỳ luân nhiệt: 95 o C-5 phút  [95 o C-30 giây, 55 o C-30 giây, 72 o C-60 giây]x40 chu kì 72 o C-5 phút. c. Qui trình tinh sạch sản phẩm PCR-Sequencing - Thêm vào mỗi giếng 32l Isopropyl alcohol (3Iso : 1 H20). - Lắc 500 rpm/1phút ở nhiệt độ phòng 30 phút. - Ly tâm 3600 rpm/30 phút/10 o C. - Ly tâm ngược plate 96rpm/30giây. - Thêm vào mỗi giếng 80l Isopropyl alcohol 75%. - Để ở nhiệt độ phòng 3 phút. - Ly tâm 3600rpm/10 phút/ 10 o C. - Ly tâm ngược plate. - Đặt plate vào tủ ấm 56 o C/20 phút. - Thêm vào mỗi giếng 10l nước cất khử ion.
51
2.2.3.5. Kỹ thuật giải trình tự xác định các biến đổi gen TP53 gen
BRAF
Xác định trình tự gen TP53 và gen BRAF được thực hiện trên máy ABI
PRISM 3130 Genetic Analyzer. Các thông số chất lượng đỉnh được thu
thập, kiểm định bằng các phần mềm ABI Data Collection v2.0 và Sequencing
Analysis Sotwave v5.3. Trình tự các đoạn gen TP53 BRAF của mẫu ung
thư da người Việt Nam được so sánh với trình tự tham chiếu công bố trên
GenBank thông qua sử dụng phần mềm phân tích BioEdit để xác định các đột
biến.
Hình 2.3. Máy xác định trình tự gen ABI PRISM 3130 Genetic Analyzer
2.2.3.6. Kỹ thuật hóa mô miễn dịch
Kỹ thuật hóa miễn dịch phương pháp áp dụng các nguyên lý
kỹ thuật miễn dịch để nghiên cứu tế bào và mô. Dựa trên sự biểu lộ đặc hiệu
của các kháng nguyên bề mặt tế bào hay tại khu vực gian bào, các kháng thể
đặc hiệu sẽ giúp cho việc nhận ra và phân loại các tế bào hay mô trên lát cắt
51 2.2.3.5. Kỹ thuật giải trình tự và xác định các biến đổi gen TP53 và gen BRAF Xác định trình tự gen TP53 và gen BRAF được thực hiện trên máy ABI PRISM 3130 Genetic Analyzer. Các thông số và chất lượng đỉnh được thu thập, kiểm định bằng các phần mềm ABI Data Collection v2.0 và Sequencing Analysis Sotwave v5.3. Trình tự các đoạn gen TP53 và BRAF của mẫu ung thư da người Việt Nam được so sánh với trình tự tham chiếu công bố trên GenBank thông qua sử dụng phần mềm phân tích BioEdit để xác định các đột biến. Hình 2.3. Máy xác định trình tự gen ABI PRISM 3130 Genetic Analyzer 2.2.3.6. Kỹ thuật hóa mô miễn dịch Kỹ thuật hóa mô miễn dịch là phương pháp áp dụng các nguyên lý và kỹ thuật miễn dịch để nghiên cứu tế bào và mô. Dựa trên sự biểu lộ đặc hiệu của các kháng nguyên bề mặt tế bào hay tại khu vực gian bào, các kháng thể đặc hiệu sẽ giúp cho việc nhận ra và phân loại các tế bào hay mô trên lát cắt
52
tổ chức.
Trong các kỹ thuật sử dụng rộng rãi ngày nay, phương pháp sử dụng
phức hợp avidin - biotin được hầu hết các phòng xét nghiệm mô bệnh học
miễn dịch sử dụng trong các nghiên cứu tế bào mô. Với kỹ thuật này, ái
lực cao của avidin đối với biotin được sử dụng để gắn chất đánh dấu theo
peroxidase với kháng thể đặc hiệu kháng nguyên.
Nhuộm hoá miễn dịch theo phương pháp miễn dịch theo phương
pháp ABC, Avidin Biotin Peroxidase trên các tiêu bản chuyển đúc paraffin,
các kít được sử dụng của hãng Dako Cytomation (Đan Mạch).
Quy trình nhuộm tiêu bản hoá mô miễn dịch theo các bước sau:
- Bệnh phẩm đúc paraffin được cắt ở độ dày 4µm và dán lên các lam kính
sạch trước đó đã được nhúng vào dung dịch silane để tăng độ kết dính.
- Các tiêu bản được tẩy paraffin theo phương pháp thường qui.
- Sau đó được thực hiện qua các bước sau:
+ Khử hoạt động của peroxidase nội sinh bằng dung dịch H
2
O
2
0,6% trong
cồn methylic, để ở nhiệt độ phòng 30 phút.
+ Rửa tiêu bản bằng nước cất 2 lần trong 5 phút.
+ Nhỏ dung dịch PBS (Phosphate Buffer Saline) trong 15 phút ở nhiệt độ
phòng với pH = 7,4 chứa 5% huyết thanh không miễn dịch 0,05%
tween 20.
+ Ủ với kháng thể đơn dòng đã được pha loãng 3% ở nhiệt độ 37
0
C trong
15 phút.
+ Rửa tiêu bản bằng dung dịch PBS, sau đó ủ tiêu bản với kháng thể kháng
IgG chuột đã được biotine hóa (pha loãng với tỷ lệ 1:200) nhiệt độ 37
0
C
trong 10 phút.
+ Rửa tiêu bản bằng dung dịch PBS 2 lần.
52 tổ chức. Trong các kỹ thuật sử dụng rộng rãi ngày nay, phương pháp sử dụng phức hợp avidin - biotin được hầu hết các phòng xét nghiệm mô bệnh học và miễn dịch sử dụng trong các nghiên cứu tế bào và mô. Với kỹ thuật này, ái lực cao của avidin đối với biotin được sử dụng để gắn chất đánh dấu theo peroxidase với kháng thể đặc hiệu kháng nguyên. Nhuộm hoá mô miễn dịch theo phương pháp miễn dịch theo phương pháp ABC, Avidin Biotin Peroxidase trên các tiêu bản chuyển đúc paraffin, các kít được sử dụng của hãng Dako Cytomation (Đan Mạch). Quy trình nhuộm tiêu bản hoá mô miễn dịch theo các bước sau: - Bệnh phẩm đúc paraffin được cắt ở độ dày 4µm và dán lên các lam kính sạch trước đó đã được nhúng vào dung dịch silane để tăng độ kết dính. - Các tiêu bản được tẩy paraffin theo phương pháp thường qui. - Sau đó được thực hiện qua các bước sau: + Khử hoạt động của peroxidase nội sinh bằng dung dịch H 2 O 2 0,6% trong cồn methylic, để ở nhiệt độ phòng 30 phút. + Rửa tiêu bản bằng nước cất 2 lần trong 5 phút. + Nhỏ dung dịch PBS (Phosphate Buffer Saline) trong 15 phút ở nhiệt độ phòng với pH = 7,4 có chứa 5% huyết thanh bê không miễn dịch và 0,05% tween 20. + Ủ với kháng thể đơn dòng đã được pha loãng 3% ở nhiệt độ 37 0 C trong 15 phút. + Rửa tiêu bản bằng dung dịch PBS, sau đó ủ tiêu bản với kháng thể kháng IgG chuột đã được biotine hóa (pha loãng với tỷ lệ 1:200) ở nhiệt độ 37 0 C trong 10 phút. + Rửa tiêu bản bằng dung dịch PBS 2 lần.
53
+ với phức hợp gắn Peroxydase - Avidin - Biotin (pha loãng với tỷ lệ
1:100) ở nhiệt độ 37
0
C trong 10 phút.
+ Phủ dung dịch diaminobenzidine.
+ Rửa tiêu bản dưới vòi nước chảy nhẹ.
+ Nhuộm Hematoxyline.
+ Khử nước, làm sạch tiêu bản, gắn kính rồi đọc kết quả trên kính hiển
vi quang học.
* Đối với p53:
- Kháng thể 1: kháng thể đơn dòng chuột chống p53 đột biến.
- Kháng thể 2: Kháng thể ngựa chống Ig chuột.
* Đối với BRAF(V600E):
- Kháng thể 1: kháng thể đơn dòng chuột chống BRAF(V600E) đột
biến.
- Kháng thể 2: Kháng thể ngựa chống Ig chuột.
- Cách đánh giá kết quả [69].
+ Tế bào âm tính: tế bào bắt màu xanh tím.
+ Tế bào dương tính: nhân các tế bào bắt màu nâu.
+ Dựa vào tỷ lệ % các tế bào dương tính chia các mức sau:
< 5% tế bào bắt mầu: âm tính
5 - 25% tế bào bắt mầu: dương tính (+)
26 - 50% tế bào bắt mầu: dương tính (++)
51 - 75% tế bào bắt mầu: dương tính (+++)
76 - 100% tế bào bắt mầu: dương tính (++++)
53 + Ủ với phức hợp gắn Peroxydase - Avidin - Biotin (pha loãng với tỷ lệ 1:100) ở nhiệt độ 37 0 C trong 10 phút. + Phủ dung dịch diaminobenzidine. + Rửa tiêu bản dưới vòi nước chảy nhẹ. + Nhuộm Hematoxyline. + Khử nước, làm sạch tiêu bản, gắn lá kính rồi đọc kết quả trên kính hiển vi quang học. * Đối với p53: - Kháng thể 1: kháng thể đơn dòng chuột chống p53 đột biến. - Kháng thể 2: Kháng thể ngựa chống Ig chuột. * Đối với BRAF(V600E): - Kháng thể 1: kháng thể đơn dòng chuột chống BRAF(V600E) đột biến. - Kháng thể 2: Kháng thể ngựa chống Ig chuột. - Cách đánh giá kết quả [69]. + Tế bào âm tính: tế bào bắt màu xanh tím. + Tế bào dương tính: nhân các tế bào bắt màu nâu. + Dựa vào tỷ lệ % các tế bào dương tính chia các mức sau: < 5% tế bào bắt mầu: âm tính 5 - 25% tế bào bắt mầu: dương tính (+) 26 - 50% tế bào bắt mầu: dương tính (++) 51 - 75% tế bào bắt mầu: dương tính (+++) 76 - 100% tế bào bắt mầu: dương tính (++++)
54
2.3. THỜI GIAN VÀ ĐỊA ĐIỂM NGHIÊN CỨU
2.3.1. Thời gian nghiên cứu
- Nghiên cứu được tiến hành từ tháng 9 năm 2011 đến tháng 9/2016.
2.3.2. Địa điểm nghiên cứu
- Bệnh viện Da liễu Trung ương, là nơi cung cấp bệnh nhân ung thư da.
- Bộ môn Miễn dịch - Sinh lý bệnh, bộ môn Giải phẫu bệnh và bộ môn
Y sinh học - Di truyền trường Đại học Y Nội sở tiến hành xét
nghiệm chiết tách DNA, khuyếch đại gen, giải trình tự gen xác định đột biến
gen TP53, BRAF hóa miễn dịch xác định sự biểu lộ protein đột biến
của gen TP53, BRAF trong mô ung thư da.
2.4. ĐẠO ĐỨC TRONG NGHIÊN CỨU
- Nghiên cứu này là một phần của đề tài cấp nhà nước, đã được thông
qua hội đồng đạo đức của Bệnh viện Da liễu Trung ương và hội đồng bảo vệ
đề cương nghiên cứu sinh, đảm bảo được các nội dung sau:
- Nghiên cứu mang tính nhân văn vì hầu hết bệnh nhân bị ung thư da là
do hậu quả của nhiều năm lao động phơi nắng, đặc biệt những người nông
dân, những người vốn đã phải chịu nhiều thiệt thòi trong hội lại tỷ lệ
mắc ung thư da cao nhất. Do thiếu hiểu biết về bệnh kết hợp với nghèo khó
nên nhiều bệnh nhân đến khám và điều trị rất muộn khi bệnh đã lan rộng, xâm
lấn tại chỗ hay di căn xa. Đề tài nghiên cứu giúp nâng cao nhận thức, sự hiểu
biết và chủ động phát hiện bệnh. Từ đó được điều trị sớm và triệt để, hạn chế
tỷ lệ tái phát, nâng cao chất lượng cuộc sống cho người bệnh.
- Bệnh nhân sẽ được tư vấn đầy đủ, kỹ lưỡng khi tham gia nghiên cứu.
- Các thông tin của bệnh nhân trong quá trình nghiên cứu được giữ
mật và hóa trên máy vi tính trong quá trình xử lý số liệu, đảm bảo không
lộ thông tin.
54 2.3. THỜI GIAN VÀ ĐỊA ĐIỂM NGHIÊN CỨU 2.3.1. Thời gian nghiên cứu - Nghiên cứu được tiến hành từ tháng 9 năm 2011 đến tháng 9/2016. 2.3.2. Địa điểm nghiên cứu - Bệnh viện Da liễu Trung ương, là nơi cung cấp bệnh nhân ung thư da. - Bộ môn Miễn dịch - Sinh lý bệnh, bộ môn Giải phẫu bệnh và bộ môn Y sinh học - Di truyền trường Đại học Y Hà Nội là cơ sở tiến hành xét nghiệm chiết tách DNA, khuyếch đại gen, giải trình tự gen xác định đột biến gen TP53, BRAF và hóa mô miễn dịch xác định sự biểu lộ protein đột biến của gen TP53, BRAF trong mô ung thư da. 2.4. ĐẠO ĐỨC TRONG NGHIÊN CỨU - Nghiên cứu này là một phần của đề tài cấp nhà nước, đã được thông qua hội đồng đạo đức của Bệnh viện Da liễu Trung ương và hội đồng bảo vệ đề cương nghiên cứu sinh, đảm bảo được các nội dung sau: - Nghiên cứu mang tính nhân văn vì hầu hết bệnh nhân bị ung thư da là do hậu quả của nhiều năm lao động phơi nắng, đặc biệt những người nông dân, những người vốn đã phải chịu nhiều thiệt thòi trong xã hội lại có tỷ lệ mắc ung thư da cao nhất. Do thiếu hiểu biết về bệnh kết hợp với nghèo khó nên nhiều bệnh nhân đến khám và điều trị rất muộn khi bệnh đã lan rộng, xâm lấn tại chỗ hay di căn xa. Đề tài nghiên cứu giúp nâng cao nhận thức, sự hiểu biết và chủ động phát hiện bệnh. Từ đó được điều trị sớm và triệt để, hạn chế tỷ lệ tái phát, nâng cao chất lượng cuộc sống cho người bệnh. - Bệnh nhân sẽ được tư vấn đầy đủ, kỹ lưỡng khi tham gia nghiên cứu. - Các thông tin của bệnh nhân trong quá trình nghiên cứu được giữ bí mật và mã hóa trên máy vi tính trong quá trình xử lý số liệu, đảm bảo không lộ thông tin.
55
2.5. QUẢN LÝ THÔNG TIN
- Các trường hợp nghiên cứu đều được ghi nhận đầy đủ thông tin và mã
hóa các dữ liệu.
- Lưu giữ số liệu bằng chương trình Excel 2010.
2.6. PHÂN TÍCH XỬ LÝ SỐ LIỆU
Các số liệu thu được xử lý bằng:
- Chương trình Epi Info và phần mềm SPSS.
- So sánh hai hay nhiều tỷ lệ % được thực hiện bằng test thống kê
2
.
55 2.5. QUẢN LÝ THÔNG TIN - Các trường hợp nghiên cứu đều được ghi nhận đầy đủ thông tin và mã hóa các dữ liệu. - Lưu giữ số liệu bằng chương trình Excel 2010. 2.6. PHÂN TÍCH XỬ LÝ SỐ LIỆU Các số liệu thu được xử lý bằng: - Chương trình Epi Info và phần mềm SPSS. - So sánh hai hay nhiều tỷ lệ % được thực hiện bằng test thống kê  2 .
56
Chƣơng 3
KẾT QUẢ
3.1. KẾT QUẢ VỀ THÔNG TIN CHUNG CỦA ĐỐI TƢỢNG NGHIÊN
CỨU
Nghiên cứu được thực hiện trên 63 bệnh nhân ung thư da, gồm 3
nhóm ung thư da chính: ung thư tế bào đáy 21 bệnh nhân, ung thư tế bào vảy
21 bệnh nhân và ung thư tế bào hắc tố 21 bệnh nhân.
Bảng 3.1. Phân bố tỷ lệ ung thƣ da theo tuổi
Loại UT
da
UT TB đáy
(n=21)
UT TB vảy
(n=21)
UT TB hắc tố
(n=21)
Tỷ lệ UT da
(n = 63)
Nhóm
tuổi
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
<40
1
4,8
0
0
2
9,5
3
4,8
40 - 49
3
14,3
1
4,8
5
23,8
9
19,0
50 - 59
7
33,3
7
33,3
7
33,3
21
33,3
60 - 69
1
4,8
6
28,6
3
14,3
10
15,9
>=70
9
42,9
7
33,3
4
19,0
20
31,7
Tổng
21
100
21
100
21
100
63
100
Về tỷ lệ nhóm tuổi trong ung thư da, hai nhóm tuổi 50 - 59 và trên 70
tuổi chiếm tỷ lệ cao ở cả 3 loại ung thư tế bào đáy, tế bào vảy và tế bào hắc
tố, tỷ lệ của các nhóm tuổi này lần lượt 33,3% 31,7%; còn nhóm tuổi
dưới 40 chiếm tỷ lệ thấp nhất 4,8%.
56 Chƣơng 3 KẾT QUẢ 3.1. KẾT QUẢ VỀ THÔNG TIN CHUNG CỦA ĐỐI TƢỢNG NGHIÊN CỨU Nghiên cứu được thực hiện trên 63 bệnh nhân ung thư da, gồm 3 nhóm ung thư da chính: ung thư tế bào đáy 21 bệnh nhân, ung thư tế bào vảy 21 bệnh nhân và ung thư tế bào hắc tố 21 bệnh nhân. Bảng 3.1. Phân bố tỷ lệ ung thƣ da theo tuổi Loại UT da UT TB đáy (n=21) UT TB vảy (n=21) UT TB hắc tố (n=21) Tỷ lệ UT da (n = 63) Nhóm tuổi Số lượng Tỷ lệ % Số lượng Tỷ lệ % Số lượng Tỷ lệ % Số lượng Tỷ lệ % <40 1 4,8 0 0 2 9,5 3 4,8 40 - 49 3 14,3 1 4,8 5 23,8 9 19,0 50 - 59 7 33,3 7 33,3 7 33,3 21 33,3 60 - 69 1 4,8 6 28,6 3 14,3 10 15,9 >=70 9 42,9 7 33,3 4 19,0 20 31,7 Tổng 21 100 21 100 21 100 63 100 Về tỷ lệ nhóm tuổi trong ung thư da, hai nhóm tuổi 50 - 59 và trên 70 tuổi chiếm tỷ lệ cao ở cả 3 loại ung thư tế bào đáy, tế bào vảy và tế bào hắc tố, tỷ lệ của các nhóm tuổi này lần lượt là 33,3% và 31,7%; còn nhóm tuổi dưới 40 chiếm tỷ lệ thấp nhất 4,8%.
57
Bảng 3.2. Phân bố tỷ lệ ung thƣ da theo giới
Loại
UT da
UT TB đáy
(n=21)
UT TB vảy
(n=21)
UT TB hắc
tố (n=21)
Tỷ lệ UT da
(n = 63)
Giới
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
Số
lượng
Tỷ lệ
%
Nam
11
52,4
13
61,9
9
42,9
33
52,4
Nữ
10
47,6
8
38,1
12
57,1
30
47,6
Tổng
21
100
21
100
21
100
63
100
Về tỷ lệ giới tính trong nghiên cứu thu được tỷ lệ nam, nữ gần tương
đương đương nhau, tỷ lệ giới nam/nữ là 1,1.
3.2. KẾT QUẢ XÁC ĐỊNH CÁC ĐỘT BIẾN GEN TP53
3.2.1. Kết quả đột biến gen TP53 bằng phương pháp giải trình tự gen
3.2.1.1. Kết quả khuếch đại gen TP53 bằng kỹ thuật PCR
Khi khuếch đại các đoạn gen TP53 bằng phương pháp PCR, chúng tôi
thu được đúng các sản phẩm theo phân đoạn, exon 2 - 4 là 611bp; exon 5 - 6
là 378bp; exon 7 - 9 là 755bp so sánh với thang chuẩn DNA (M).
Hình 3.1. Sản phẩm PCR đƣợc khuếch đại từ exon 2 4 (611bp)
0,611kb
57 Bảng 3.2. Phân bố tỷ lệ ung thƣ da theo giới Loại UT da UT TB đáy (n=21) UT TB vảy (n=21) UT TB hắc tố (n=21) Tỷ lệ UT da (n = 63) Giới Số lượng Tỷ lệ % Số lượng Tỷ lệ % Số lượng Tỷ lệ % Số lượng Tỷ lệ % Nam 11 52,4 13 61,9 9 42,9 33 52,4 Nữ 10 47,6 8 38,1 12 57,1 30 47,6 Tổng 21 100 21 100 21 100 63 100 Về tỷ lệ giới tính trong nghiên cứu thu được tỷ lệ nam, nữ gần tương đương đương nhau, tỷ lệ giới nam/nữ là 1,1. 3.2. KẾT QUẢ XÁC ĐỊNH CÁC ĐỘT BIẾN GEN TP53 3.2.1. Kết quả đột biến gen TP53 bằng phương pháp giải trình tự gen 3.2.1.1. Kết quả khuếch đại gen TP53 bằng kỹ thuật PCR Khi khuếch đại các đoạn gen TP53 bằng phương pháp PCR, chúng tôi thu được đúng các sản phẩm theo phân đoạn, exon 2 - 4 là 611bp; exon 5 - 6 là 378bp; exon 7 - 9 là 755bp so sánh với thang chuẩn DNA (M). Hình 3.1. Sản phẩm PCR đƣợc khuếch đại từ exon 2  4 (611bp) 0,611kb